View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21247_low_10 (Length: 293)
Name: NF21247_low_10
Description: NF21247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21247_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 31267413 - 31267276
Alignment:
| Q |
1 |
catgttttatcttttggtacacacattgttggacatgaacccattctattggtggcccacttactcattttagaaacttttattctagaaagacaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31267413 |
catgttttatcttttggtacacacattgttggacatgaacccattctattggtggcccacttactcattttagaaacttttattctagaaagacaaataa |
31267314 |
T |
|
| Q |
101 |
gaggacaaaattaatatttttaatcttttgtcctattc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31267313 |
gaggacaaaattaatatttttaatcttttgtcctattc |
31267276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University