View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21248_high_14 (Length: 264)
Name: NF21248_high_14
Description: NF21248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21248_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 2 - 256
Target Start/End: Complemental strand, 40902915 - 40902661
Alignment:
| Q |
2 |
gaattatgcaaaccacagagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaaccgagaagccaatgtaatcttc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40902915 |
gaattatgcaaaccacagagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaactgagaaaccaatgtaatcttc |
40902816 |
T |
 |
| Q |
102 |
cgtatttaaacgtatgtgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttgg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40902815 |
cgtatttaaacgtatgtgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttcg |
40902716 |
T |
 |
| Q |
202 |
actccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902715 |
actccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
40902661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 170 - 256
Target Start/End: Complemental strand, 30149676 - 30149590
Alignment:
| Q |
170 |
gcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
256 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
30149676 |
gcaggcagattttgttcatggttcagatttcgactccaacttcatttccagttctgcacaccatcggtctcatacagtttctgtgct |
30149590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University