View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21248_high_8 (Length: 381)
Name: NF21248_high_8
Description: NF21248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21248_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Original strand, 42745532 - 42745902
Alignment:
| Q |
1 |
tttgcttatggactctgatcccaactttgcacagagatcctgaaatttggggaccagattccaacgagtttaaacccgaaaggttcagtgagggtgtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745532 |
tttgcttatggactctgatcccaactttgcacagagatcctgaaatttggggaccagattccaacgagtttaaacccgaaaggttcagtgagggtgtgtc |
42745631 |
T |
 |
| Q |
101 |
gaaggctatcaagtttccacaagcgtatgtgccatttggaatcggcactcggttgtgcgtggggaagaactttgcaatggttgaactaaaggttgtgcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745632 |
taaggctatcaagtttccacaagcgtatgtgccatttggaatcggcactcggttgtgcgtggggaagaactttgcaatggttgaactaaaggttgtgcta |
42745731 |
T |
 |
| Q |
201 |
gcccttattgtctccaagttcagcttctctttgtctcctagttataagcattctcctgcatataatatgattgtagagccaggacatggtgtgtatcttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745732 |
gcccttattgtctccaagttcagcttctctttgtctcctagttataagcattctcctgcatataatatgattgtagagccaggacatggtgtgtatcttc |
42745831 |
T |
 |
| Q |
301 |
tcattcagaagaactgatgaaaccaattcatcaactttaatgcacaagcatttgatttcttctggcctatg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42745832 |
tcattcagaagaactgatgaaaccaattcatcaactttaatgcacaatcatttgatttcttctggcctatg |
42745902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University