View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21248_low_16 (Length: 231)
Name: NF21248_low_16
Description: NF21248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21248_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 51 - 218
Target Start/End: Complemental strand, 28692934 - 28692767
Alignment:
| Q |
51 |
tatagtactaatcttattttaatttatgagcatttaaaacaaaaggagtggaagaatcaatcccaattaaatggagttagagcaagcaaaggaagagttg |
150 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28692934 |
tatagaactaatcttattttaatttatgagcatttaaaacaaaaggagtggaagaatcaatcacaattaaatggagttagagcaagcaaaggaagagttg |
28692835 |
T |
|
| Q |
151 |
gagatgcttgaaaccctttaccctaatcaacatgactatctcaaacatgaacttaggtctttcatctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28692834 |
gagatgcttgaaaccctttaccctaatcaacatgactatctcaaacatgaacttaggtctttcatctc |
28692767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University