View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124R-Insertion-10 (Length: 62)
Name: NF2124R-Insertion-10
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124R-Insertion-10 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 14060959 - 14061012
Alignment:
| Q |
9 |
agttgtgccttttttagttgggaaatccttttatccataagcgtatgagtcatg |
62 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14060959 |
agttgtgcctcttttagttgggaaatccttttatccataagcgtatgagtcatg |
14061012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 14049574 - 14049627
Alignment:
| Q |
9 |
agttgtgccttttttagttgggaaatccttttatccataagcgtatgagtcatg |
62 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
14049574 |
agttgtacctcttttagttgggaaagccttttatccgtaagtgtatgagtcatg |
14049627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University