View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124R-Insertion-2 (Length: 321)
Name: NF2124R-Insertion-2
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124R-Insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 309
Target Start/End: Original strand, 46761402 - 46761719
Alignment:
| Q |
8 |
aggaggaacaacaaccctagttgataagatcggttattgcatccgtaattctagagttttctctaaaccttctcctcc------ttctccgcctattcct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46761402 |
aggaggaacaacaaccctagttgataagatcggttattgcatccgtaattctagagttttctctaaaccttctcctccttctccttctccgcctattcct |
46761501 |
T |
|
| Q |
102 |
cctccaatttgatggcgcaaaggcgagttgatcggttgtggtgcctttggtcatgtttacgttggtatgaatctcgattctggagagcttcttgctgtta |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46761502 |
cctccaattcgatggcgcaaaggcgagttgatcggttgtggtgcctttggtcatgtttacgttggtatgaatctcgattctggagagcttcttgctgtca |
46761601 |
T |
|
| Q |
202 |
aacaggtattcatttcacaatcgattcttcaactttc----------tttaatttgatttcaactggttttggatttaactttaaagcttacgttgattt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46761602 |
aacaggtattcatttcacaatcgattcttcaactttctttaattgtgtttaatttgatttcaactggttttggatttaactttaaagcttacgttgattt |
46761701 |
T |
|
| Q |
292 |
tgtttacttgttttattc |
309 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
46761702 |
tgtttacttgtttgattc |
46761719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University