View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124R-Insertion-6 (Length: 205)
Name: NF2124R-Insertion-6
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124R-Insertion-6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 30399717 - 30399914
Alignment:
| Q |
8 |
attaacttgcactaaaactgtgaatacccaaaataaatctacacttcaaatttatttaatgtaaatttcagaaacacgttacgttacaccaaagaaaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30399717 |
attaacttgcactaaaactgtgaatacccaaaataaatctacacttcaaatttatttaatgtaaatttcagaaacacgttacattacaccaaagaaaaat |
30399816 |
T |
 |
| Q |
108 |
gccaaaactagtttaaatctcagtcgtggcatgccactgttcctctgctttctcacacannnnnnnctctgacaactactgaagttgctctgtctctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30399817 |
gccaaaactagtttaaatctcagtcgtggcatgccactgttcctctgctttctcacacatttttttctctgacaactactgaagttgctctgtctctg |
30399914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University