View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124R-Insertion-8 (Length: 148)
Name: NF2124R-Insertion-8
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124R-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 43 - 148
Target Start/End: Original strand, 51761514 - 51761619
Alignment:
| Q |
43 |
ttcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacataactccctcacactccttgctttcttcatg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51761514 |
ttcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacataactccctcacactccatgctttcttcatg |
51761613 |
T |
|
| Q |
143 |
atcttg |
148 |
Q |
| |
|
|||||| |
|
|
| T |
51761614 |
atcttg |
51761619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University