View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2124R-Insertion-9 (Length: 100)

Name: NF2124R-Insertion-9
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2124R-Insertion-9
NF2124R-Insertion-9
[»] chr6 (1 HSPs)
chr6 (9-100)||(10117577-10117669)
[»] chr7 (1 HSPs)
chr7 (46-86)||(1446877-1446917)


Alignment Details
Target: chr6 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 10117669 - 10117577
Alignment:
9 aaaaccccaaaaaccttggccatttaaaccggcgaat-gaatccttgttgcttctaaaccctatttgcttccaaccctagctgttaattaccg 100  Q
    |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||    
10117669 aaaaccccgaaaaccttggccatttaaaccggcgaatagaatccttgttgcttctaaaccctatttgcttctaaccctagctgttagttaccg 10117577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Complemental strand, 1446917 - 1446877
Alignment:
46 gaatccttgttgcttctaaaccctatttgcttccaacccta 86  Q
    ||||| ||| ||||||||||||||||| |||||||||||||    
1446917 gaatcgttgatgcttctaaaccctattagcttccaacccta 1446877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University