View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124R-Insertion-9 (Length: 100)
Name: NF2124R-Insertion-9
Description: NF2124R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124R-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 10117669 - 10117577
Alignment:
| Q |
9 |
aaaaccccaaaaaccttggccatttaaaccggcgaat-gaatccttgttgcttctaaaccctatttgcttccaaccctagctgttaattaccg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
10117669 |
aaaaccccgaaaaccttggccatttaaaccggcgaatagaatccttgttgcttctaaaccctatttgcttctaaccctagctgttagttaccg |
10117577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Complemental strand, 1446917 - 1446877
Alignment:
| Q |
46 |
gaatccttgttgcttctaaaccctatttgcttccaacccta |
86 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1446917 |
gaatcgttgatgcttctaaaccctattagcttccaacccta |
1446877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University