View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2124_high_12 (Length: 237)

Name: NF2124_high_12
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2124_high_12
NF2124_high_12
[»] scaffold0775 (1 HSPs)
scaffold0775 (1-221)||(513-733)
[»] chr2 (1 HSPs)
chr2 (17-94)||(22529911-22529988)
[»] chr6 (1 HSPs)
chr6 (55-95)||(21603346-21603386)


Alignment Details
Target: scaffold0775 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0775
Description:

Target: scaffold0775; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 733 - 513
Alignment:
1 acaggtggatctgctgtggcggtacaaggaaggatatatggtacggtatggacgggtgtctcccccaaagatttttccacctattccgggatctcatttg 100  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
733 acaggtggatctgccgtggcggtacaaggaaggatatatggtatggtatggacgggtgtctcccccaaagatttttccacctattccgggatctcatttg 634  T
101 aggcaagtgattaaggagcagatcattgcacaccagcagcaacaccaccaggagagaggctcacctgataccattcaaatggtgagtggtgatgttagcc 200  Q
    ||||||| |||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
633 aggcaagcgattgaggagcaaatcattgcacaccagcagcagcaccaccaggagagaggctcacctgataccattcaaatggtgagtggtgatgttagcc 534  T
201 aaactgttgagtatttggttc 221  Q
    |||||||||||||||||||||    
533 aaactgttgagtatttggttc 513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 22529988 - 22529911
Alignment:
17 tggcggtacaaggaaggatatatggtacggtatggacgggtgtctcccccaaagatttttccacctattccgggatct 94  Q
    ||||||| | |||| ||||||||| || |||||| ||| ||||||| |||  ||||||| ||||||||||| ||||||    
22529988 tggcggttcgaggatggatatatgctatggtatgtacgtgtgtctcaccctcagattttgccacctattccaggatct 22529911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 21603346 - 21603386
Alignment:
55 ggtgtctcccccaaagatttttccacctattccgggatctc 95  Q
    |||||||| |||  |||||||||||||||||||||||||||    
21603346 ggtgtctcaccctcagatttttccacctattccgggatctc 21603386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University