View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124_high_12 (Length: 237)
Name: NF2124_high_12
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124_high_12 |
 | |
|
| [»] scaffold0775 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0775 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 733 - 513
Alignment:
| Q |
1 |
acaggtggatctgctgtggcggtacaaggaaggatatatggtacggtatggacgggtgtctcccccaaagatttttccacctattccgggatctcatttg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
733 |
acaggtggatctgccgtggcggtacaaggaaggatatatggtatggtatggacgggtgtctcccccaaagatttttccacctattccgggatctcatttg |
634 |
T |
|
| Q |
101 |
aggcaagtgattaaggagcagatcattgcacaccagcagcaacaccaccaggagagaggctcacctgataccattcaaatggtgagtggtgatgttagcc |
200 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
633 |
aggcaagcgattgaggagcaaatcattgcacaccagcagcagcaccaccaggagagaggctcacctgataccattcaaatggtgagtggtgatgttagcc |
534 |
T |
|
| Q |
201 |
aaactgttgagtatttggttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
533 |
aaactgttgagtatttggttc |
513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 22529988 - 22529911
Alignment:
| Q |
17 |
tggcggtacaaggaaggatatatggtacggtatggacgggtgtctcccccaaagatttttccacctattccgggatct |
94 |
Q |
| |
|
||||||| | |||| ||||||||| || |||||| ||| ||||||| ||| ||||||| ||||||||||| |||||| |
|
|
| T |
22529988 |
tggcggttcgaggatggatatatgctatggtatgtacgtgtgtctcaccctcagattttgccacctattccaggatct |
22529911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 21603346 - 21603386
Alignment:
| Q |
55 |
ggtgtctcccccaaagatttttccacctattccgggatctc |
95 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
21603346 |
ggtgtctcaccctcagatttttccacctattccgggatctc |
21603386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University