View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124_low_11 (Length: 242)
Name: NF2124_low_11
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 25 - 227
Target Start/End: Original strand, 4366444 - 4366647
Alignment:
| Q |
25 |
taaaatgagaatataaaattgagaacaaatttttggtcctgcgaataatttattgagaatatatatttt-ttaactcctttctaccaaacatgagattac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4366444 |
taaaatgagaatataaaattgagaacaaatttttagtcctgcgaatagtttattgagaatatatatttttttaactcttttctaccaaacatgagattac |
4366543 |
T |
|
| Q |
124 |
ttcaggaatcatccatacagaaatatttgcaggtttagatacaaacatttcctacgactctatctaagcaattcaggtttgtatacaaatattagtgaaa |
223 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
4366544 |
tccaggaatcatccacacagaaatatttgcaggtttagatacaaacatttcctaagaatctacctacgcaattcaggtttagatacaaatatttgtgaaa |
4366643 |
T |
|
| Q |
224 |
tctc |
227 |
Q |
| |
|
|||| |
|
|
| T |
4366644 |
tctc |
4366647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University