View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124_low_14 (Length: 216)
Name: NF2124_low_14
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 1702160 - 1702342
Alignment:
| Q |
21 |
catcgctcaccctcatgtctcactctcatgttccacaaaaattctggtgttatgccttccaaatggcggtgtatttaataaatcgcatgacaacaacaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1702160 |
catcgctcaccctcatgtctcactctcatgttccacaaaaattctggtgttatgccttccaaatggcggtgtatttaataaatcgcatgccaacaacaca |
1702259 |
T |
|
| Q |
121 |
tcttaaaaacaaatgtcctaatgaaattctgtttggttccactcctaattatcttaatcttggagtctttggatatctgtgct |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
1702260 |
tcttaaaaacaaatgtcctcatgaaattctgtttggttccactcctaattatcttaatcttcgagtctttggatgtctgtgct |
1702342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University