View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124_low_2 (Length: 376)
Name: NF2124_low_2
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 3425672 - 3425315
Alignment:
| Q |
1 |
gaactcgagcagaaatagaaaggatggacagtgcaaacttttgcacagaaatagagcaaggatggagaacaatgatgacataaccaggctctcataagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425672 |
gaactcgagcagaaatagaaaggatggacagtgcaaacttttgcacagaaatagagcaaggatggagaacaatgatgacataaccaggctctcataagtc |
3425573 |
T |
|
| Q |
101 |
ataccatatttgtcttatagggcacaagagtgtgtatgatagctattgtagatacgctatacaagattctagctatgacagttaattatggataactaac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425572 |
ataccatatttgtcttataggacacaagagtgtgtatgatagctattgtagatacgctatacaagattctagctatgacagttaattatggataactaac |
3425473 |
T |
|
| Q |
201 |
aagataacttgctacacaagttatctctgtgaatgacactaacttccttattttcatggtcaatacaaggcaacaatgacagaactcaaactcaaagata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425472 |
aagataacttgctacacaagttatctctgtgaatgacactaacttccttattttcatggtcaatacaaggcaacaatgacagaactcaaactcaaagata |
3425373 |
T |
|
| Q |
301 |
cggtaacaggatttttgagaatttttccctaaaattgcaatagcagacatcaaatcac |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3425372 |
cggtaacaggatttttgagaatttttccctaaaattgcaatagcagatatcaaatcac |
3425315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University