View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2124_low_7 (Length: 253)
Name: NF2124_low_7
Description: NF2124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2124_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 60 - 238
Target Start/End: Original strand, 7870931 - 7871109
Alignment:
| Q |
60 |
ctggttttcattttgagcatcccatgcttcactgcgtggcatataatgatgattgatgcataacagaagaagagtctatgaagactatatttatgttagt |
159 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7870931 |
ctggttttcattttgagcattgggtgcttcactgcgtggcatataatgatgattgatgcataacagaagaagagtctatgaagactatatttatgttagt |
7871030 |
T |
|
| Q |
160 |
ggctagtgtagggtatttaggagtagtcagaaatgtttttaaattggataaactcacatgtataaccggagttgtaaaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871031 |
ggctagtgtagggtatttaggagtagtcagaaatgtttttaaattggataaactcacatgtataaccggagttgtaaaa |
7871109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University