View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21250_high_8 (Length: 266)
Name: NF21250_high_8
Description: NF21250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21250_high_8 |
 |  |
|
| [»] scaffold0769 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 46355592 - 46355546
Alignment:
| Q |
21 |
gtatgggatgtgtctaaatcttattctccagcggtagttaactaccg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355592 |
gtatgggatgtgtctaaatcttattctccagcggtagttaactaccg |
46355546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 46356116 - 46356169
Alignment:
| Q |
178 |
ttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
46356116 |
ttttagtaaattacttatgtcaataagaagtattatatgtcaaaaaagcaattt |
46356169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 231
Target Start/End: Original strand, 12028374 - 12028433
Alignment:
| Q |
172 |
gggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
12028374 |
gggactttttagtaaattatttgtgtcaataggaagtattccatgtcaaaaaagcaattt |
12028433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 20855175 - 20855128
Alignment:
| Q |
20 |
ggtatgggatgtgtctaaatcttattctccagcggtagttaactaccg |
67 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20855175 |
ggtatgagatgtgtctaaatcttattctacagcggtagttaactaccg |
20855128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 20902517 - 20902560
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20902517 |
ttacttatgtcaataggaagtattctatgtcagaaaagcaattt |
20902560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 46518337 - 46518392
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
46518337 |
ctttttagtaaattacttgtgtcaataggaagtattccatgtcaaaaaagcaattt |
46518392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 211
Target Start/End: Complemental strand, 20855098 - 20854991
Alignment:
| Q |
105 |
aagctgtgttaatgtacaacggaagttaactaccgctggaacaat-caacagtagttaactactaattgggactttttagtaaattacttatgtcaatag |
203 |
Q |
| |
|
||||||||||| |||||| ||| |||||| |||||| ||| |||| |||| ||| |||||||| | || |||||||||||||||||| ||||||||| |
|
|
| T |
20855098 |
aagctgtgttagtgtacagcggtagttaattaccgccggatcaattcaacggtaattaactaccgctgggagctttttagtaaattacttgtgtcaatag |
20854999 |
T |
 |
| Q |
204 |
gaagtatt |
211 |
Q |
| |
|
||||||| |
|
|
| T |
20854998 |
aaagtatt |
20854991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 21168462 - 21168419
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21168462 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
21168419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 45936651 - 45936608
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45936651 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
45936608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 46355436 - 46355381
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| ||||||| |||| |||||| |
|
|
| T |
46355436 |
ctttttagtaaattacttgtgttaataggaagtattatatgtcaaaaaaacaattt |
46355381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 49790662 - 49790619
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49790662 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
49790619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 51026038 - 51025991
Alignment:
| Q |
184 |
taaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
51026038 |
taaattacttgtgtcaataggaagtattctatgtcaaaaaagcaattt |
51025991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 51029612 - 51029655
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51029612 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
51029655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 11284286 - 11284243
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11284286 |
ttacttatgtcaataggaagtttcctatgtcagaaaagcaattt |
11284243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 32715326 - 32715271
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||| || |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
32715326 |
ctttttagtaaattatttgtgtcaataggaagtttcctatgtcaaaaaagcaattt |
32715271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 38193409 - 38193366
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
38193409 |
ttacttgtgtcaataggaagtattctatgtcagaaaagtaattt |
38193366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 40732467 - 40732510
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
40732467 |
ttacttgtgtcaataggaagtattctatgtcagaaaaacaattt |
40732510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 231
Target Start/End: Complemental strand, 17915216 - 17915135
Alignment:
| Q |
150 |
caacagtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||| |||||||||||| | ||| ||||||| |||||||||| |||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
17915216 |
caacggtagttaactaccgctgggggctttttaataaattacttgtgtcaataagaagtattccatgtccaaaaagcaattt |
17915135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 17112361 - 17112306
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17112361 |
ctttttggtaaattacttgtgtcaataggaagtattttatgtcaaaaaagcaattt |
17112306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 34519958 - 34519903
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34519958 |
ctttttggtaaattacttgtgtcaataggaagtattttatgtcaaaaaagcaattt |
34519903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 10361184 - 10361227
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10361184 |
ttacttatgtcaataggaagtattttatgtcagaaaaacaattt |
10361227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 149 - 231
Target Start/End: Original strand, 2121285 - 2121367
Alignment:
| Q |
149 |
tcaacagtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||| |||||||||||| | | |||||||||||||||||||| ||||||||||||||||| |||||| |||| |||||| |
|
|
| T |
2121285 |
tcaacggtagttaactaccgttggagactttttagtaaattacttgtgtcaataggaagtattccatgtcaaaaaaacaattt |
2121367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 34522709 - 34522763
Alignment:
| Q |
177 |
tttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
34522709 |
tttttggtaaattacttgtgtcaataggaagtattctatgtcagaaaatcaattt |
34522763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 27131376 - 27131419
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27131376 |
ttacttgtgtcaatagaaagtattttatgtcagaaaagcaattt |
27131419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 30497833 - 30497888
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
30497833 |
ctttttagtaaattatttatgtcaatagaaagtattacatgtcaaaaaagcaattt |
30497888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 31297685 - 31297642
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31297685 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
31297642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 4425064 - 4425021
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
4425064 |
ttacttgtgtcaataggaagtattctatgtcagaaaatcaattt |
4425021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 6976007 - 6975964
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
6976007 |
ttacttgtgtcaataggaagtattctatatcagaaaagcaattt |
6975964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 24108472 - 24108515
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
24108472 |
ttacttgtgtcaataggaagtattctatgtcagaaaaacaattt |
24108515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 192 - 231
Target Start/End: Original strand, 44037905 - 44037944
Alignment:
| Q |
192 |
ttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
44037905 |
ttatgtcaataggaagtattctatgtcagaaaaacaattt |
44037944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 230
Target Start/End: Complemental strand, 3259917 - 3259875
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaatt |
230 |
Q |
| |
|
|||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
3259917 |
ttacttgtgtcaatagaaagtattctatgtcagaaaagcaatt |
3259875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 28861982 - 28861927
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
28861982 |
ctttttagtaaattacttgtgtcaataggaagtatttcatgtcaaaaaagcaattt |
28861927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 51164645 - 51164590
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51164645 |
ctttttggtaaattacttgtgtcaataggaagtattttatgtctaaaaagcaattt |
51164590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 15356395 - 15356438
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15356395 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
15356438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 231
Target Start/End: Original strand, 46201210 - 46201269
Alignment:
| Q |
172 |
gggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
46201210 |
gggactttatagtaaattacttgtgtcaataggaaatattccatgtcaaaaaagcaattt |
46201269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 14441116 - 14441169
Alignment:
| Q |
177 |
tttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14441116 |
tttttggtaaattacttgtgtcaataggaagtattctatgtca-aaaagcaattt |
14441169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 231
Target Start/End: Complemental strand, 7402917 - 7402845
Alignment:
| Q |
158 |
gttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||| | | ||| |||||||||||||||||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
7402917 |
gttaactaccactaggggctttttagtaaattactt-tgtcaataggaagtttcctatgtcaaaaaagcaattt |
7402845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 51936604 - 51936656
Alignment:
| Q |
179 |
tttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
51936604 |
tttagtcatttacttatgtcaataggaagtattcaatgtcaaaaaagcaattt |
51936656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 35585148 - 35585105
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
35585148 |
ttacttatatcaataggaagtattctatgtcagaaaaacaattt |
35585105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 42058666 - 42058721
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| || ||| ||||||||||| |
|
|
| T |
42058666 |
ctttttggtaaattacttatgtcaatagcaagtattccatatcaaaaaagcaattt |
42058721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 46191794 - 46191751
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
46191794 |
ttacttgtgtcaataggaagtttcttatgtcagaaaagcaattt |
46191751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 211
Target Start/End: Complemental strand, 13706169 - 13706108
Alignment:
| Q |
150 |
caacagtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtatt |
211 |
Q |
| |
|
|||| |||||||||||| | ||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
13706169 |
caacggtagttaactaccgttgggggctttttagtaaattacttgtgtcaataggaaatatt |
13706108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 26067182 - 26067239
Alignment:
| Q |
174 |
gactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||| |||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
26067182 |
gactttttagtaaattatttatgtcaattgaaagtttcatatgtcaaaaaagcaattt |
26067239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 18239506 - 18239454
Alignment:
| Q |
178 |
ttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaatt |
230 |
Q |
| |
|
|||||||| |||||| |||||||||||||| || ||||||| |||||||||| |
|
|
| T |
18239506 |
ttttagtattttacttgtgtcaataggaagttttctatgtcaaaaaagcaatt |
18239454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 231
Target Start/End: Original strand, 34815693 - 34815729
Alignment:
| Q |
195 |
tgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34815693 |
tgtcaataggaaatattctatgtcagaaaagcaattt |
34815729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 150 - 231
Target Start/End: Complemental strand, 16583273 - 16583192
Alignment:
| Q |
150 |
caacagtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||| |||||||||||| | ||| |||||||||||||||||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
16583273 |
caacggtagttaactaccgctgggggctttttagtaaattacttgtgtcaataggaagtattccatgtcaaaaaagcaattt |
16583192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 158 - 231
Target Start/End: Complemental strand, 26701904 - 26701831
Alignment:
| Q |
158 |
gttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
26701904 |
gttaactaccacttggagctttttagtaaattacttgtgtcaataggaagtttcctatgtcaaaaaagcaattt |
26701831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 14737651 - 14737719
Alignment:
| Q |
156 |
tagttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaa |
224 |
Q |
| |
|
||||||||||| | | | | |||||| ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
14737651 |
tagttaactaccactggaggcttttttgtaaattacttgtgtcaataggaagtattttatgtcaaaaaa |
14737719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 8036295 - 8036252
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8036295 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
8036252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 41363027 - 41362984
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41363027 |
ttacttgtgtcaataggaagtattttatgtcagaaaaacaattt |
41362984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 21511192 - 21511247
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||| || ||||||||||| |
|
|
| T |
21511192 |
ctttttagtaaattacttgtatcaataggaagtattccatgacaaaaaagcaattt |
21511247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 27641575 - 27641532
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
27641575 |
ttacttgtgtcaatagaaagtattctatgtcagaaaagcaattt |
27641532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 38032203 - 38032148
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| |||| ||||||| ||| ||||||| |
|
|
| T |
38032203 |
ctttttggtaaattacttgtgtcaataggaaatattctatgtcaaaaaggcaattt |
38032148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 32428798 - 32428846
Alignment:
| Q |
183 |
gtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32428798 |
gtaaattacttatgtcaataggaagttttctatgtcagaaaagcaattt |
32428846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 172 - 224
Target Start/End: Original strand, 50459629 - 50459681
Alignment:
| Q |
172 |
gggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaa |
224 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
50459629 |
gggactctttggtaaattacttgtgtcaataggaagtattctatgtcagaaaa |
50459681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 30191710 - 30191667
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30191710 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
30191667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 40469241 - 40469296
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
40469241 |
ctttttagtaaattatttgtgtcaataggaagtattcaatgtcaaaaaagcaattt |
40469296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 46412515 - 46412472
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46412515 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
46412472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 48098160 - 48098203
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48098160 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
48098203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 54671229 - 54671265
Alignment:
| Q |
24 |
tgggatgtgtctaaatcttattctccagcggtagtta |
60 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54671229 |
tgggatgtgtctaaatcttattctccaacggtagtta |
54671265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 10054306 - 10054349
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
10054306 |
ttacttgtgttaataggaagtattctatgtcagaaaagcaattt |
10054349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 11379780 - 11379823
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
11379780 |
ttacttgtgtcaatagaaagtattctatgtcagaaaagcaattt |
11379823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 14633427 - 14633470
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
14633427 |
ttacttgtgtcaataggaagtattctatgtcagaaaaacaattt |
14633470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 21196462 - 21196419
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
21196462 |
ttacttgtgtcaataggaaatattctatgtcagaaaagcaattt |
21196419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 21196604 - 21196647
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
21196604 |
ttacttgtgtcaataggaagtattctatgtcaaaaaagcaattt |
21196647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 47642792 - 47642835
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
47642792 |
ttacttgtgttaataggaagtattctatgtcagaaaagcaattt |
47642835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 47760933 - 47760976
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47760933 |
ttacttgtatcaataggaagtattctatgtcagaaaagcaattt |
47760976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 50457467 - 50457424
Alignment:
| Q |
195 |
tgtcaataggaagtattttatgtcagaaaagcaatttgttagtc |
238 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
50457467 |
tgtcaataggaagtattctatgtcaaaaaagcaattttttagtc |
50457424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 33942758 - 33942806
Alignment:
| Q |
183 |
gtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
33942758 |
gtaaattacttgtgtcaataggaagtttcctatgtcacaaaagcaattt |
33942806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 10552755 - 10552700
Alignment:
| Q |
174 |
gactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaat |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
10552755 |
gactttttagtaaattacttgtgtcaataggaagtattccatgtcaaaaaagcaat |
10552700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 47868485 - 47868540
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || ||||||| ||||||||||| |
|
|
| T |
47868485 |
ctttttagtaaattacttatgtcaataggaacttttctatgtcaaaaaagcaattt |
47868540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 2206305 - 2206348
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2206305 |
ttacttgtgtcaataggaagtattctatgtcagaaaagcaattt |
2206348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 42734448 - 42734401
Alignment:
| Q |
184 |
taaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
42734448 |
taaattacttgtgtcaataggaagtattctatgttagaaaaacaattt |
42734401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 42736958 - 42737005
Alignment:
| Q |
184 |
taaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
42736958 |
taaattacttgtgtcaataggaagtattctatgtcaaaaaaacaattt |
42737005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 231
Target Start/End: Original strand, 41964787 - 41964863
Alignment:
| Q |
155 |
gtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||| | ||||| ||| ||||| |||||||||||||| |||| | || |||||||||||||||||| |
|
|
| T |
41964787 |
gtagttaactaccgctggggacgtttaagtaatttacttatgtcaattggaacttttcaatgtcagaaaagcaattt |
41964863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0769
Description:
Target: scaffold0769; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 745 - 799
Alignment:
| Q |
177 |
tttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
745 |
tttttggtaaattacttgtgtcaataggaagtattctatgtcagaaaatcaattt |
799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 231
Target Start/End: Original strand, 1973339 - 1973394
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||| |||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
1973339 |
ctttttggtaaattacttgtgtcaatatgaagtattatatgtcaaaaaagcaattt |
1973394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 11356404 - 11356361
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11356404 |
ttacttgtgtcaatagaaagtattttatgtcagaaaagcaattt |
11356361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 231
Target Start/End: Complemental strand, 26747751 - 26747696
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
26747751 |
ctttttagtaaattacttgtgtcaataggaagtttcctatgtcaaaaaagcaattt |
26747696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 6550058 - 6550008
Alignment:
| Q |
158 |
gttaactactaattgggactttttagtaaattacttatgtcaataggaagt |
208 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||||||||| |
|
|
| T |
6550058 |
gttaactactgttgggaactttttagtaaattacttatgtcaataggaagt |
6550008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 16931285 - 16931333
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaatttgttag |
236 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||| |||| |
|
|
| T |
16931285 |
ttacttatgtcaataggaaatattctatgtcaaaaaagcaattttttag |
16931333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 4722377 - 4722334
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
4722377 |
ttacttgtgtcaataggaagtattctatgtcagaaaaacaattt |
4722334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 17646640 - 17646683
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
17646640 |
ttacttgtgtcaacaggaagtattctatgtcagaaaagcaattt |
17646683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 22964712 - 22964669
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
22964712 |
ttacttatgtcaataggaagtattcaatgtcaaaaaagcaattt |
22964669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 203
Target Start/End: Complemental strand, 7250113 - 7250060
Alignment:
| Q |
150 |
caacagtagttaactactaattgggactttttagtaaattacttatgtcaatag |
203 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||| |||||||||||| |
|
|
| T |
7250113 |
caacagtagttaactaccgctggagactttttagtaaattatttatgtcaatag |
7250060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 211
Target Start/End: Complemental strand, 23062262 - 23062201
Alignment:
| Q |
150 |
caacagtagttaactactaattgggactttttagtaaattacttatgtcaataggaagtatt |
211 |
Q |
| |
|
|||| |||||||||||| ||| |||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
23062262 |
caacggtagttaactaccgcttgagactttttggtaaattatttgtgtcaataggaagtatt |
23062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 41088120 - 41088084
Alignment:
| Q |
195 |
tgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
41088120 |
tgtcaataggaagtattctatgtcagaaaagtaattt |
41088084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 43297795 - 43297843
Alignment:
| Q |
183 |
gtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
43297795 |
gtaaattacttgtgtcaataggaagtttcccatgtcagaaaagcaattt |
43297843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 229
Target Start/End: Complemental strand, 19026 - 18973
Alignment:
| Q |
176 |
ctttttagtaaattacttatgtcaataggaagtattttatgtcagaaaagcaat |
229 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||| |||| || ||||||||| |
|
|
| T |
19026 |
ctttttggtaaattacttgtgtcaataggaagtattctatgccaaaaaagcaat |
18973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 22868432 - 22868480
Alignment:
| Q |
183 |
gtaaattacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
22868432 |
gtaaattacttgtgtcaataggaagttttctatgtcaaaaaagcaattt |
22868480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 12398776 - 12398819
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12398776 |
ttacttgtgtcaataggaagtattctatgacagaaaagcaattt |
12398819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 130567 - 130610
Alignment:
| Q |
188 |
ttacttatgtcaataggaagtattttatgtcagaaaagcaattt |
231 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
130567 |
ttacttgtgtcaataggaagtattctatgtcaaaaaagcaattt |
130610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University