View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21250_low_10 (Length: 257)
Name: NF21250_low_10
Description: NF21250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21250_low_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 257
Target Start/End: Complemental strand, 2950498 - 2950257
Alignment:
| Q |
16 |
atacaaatacaatatctctgcatgatattactatgatagtggtgagatcaactttacaggctactagcattgaaggtattgaaagttcctaactcatata |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2950498 |
atacaaatacaatatctatgcatgatattactatgatagtggtgagatcaactttacaggctactagcattgaaggtattgaaagttcctaactcatata |
2950399 |
T |
 |
| Q |
116 |
atatctgtgtacagtatgtaaaggaattgcaaaaccacttgccagatatttgggatttgaccatatcattatgtacactttgtcctcttagagtctgtac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2950398 |
atatctgtgtacagtatgtaaaggaattacaaaaccacttgccagatatttgggatttgaccatatcattatgtacactttgtcctcttagagtctgtac |
2950299 |
T |
 |
| Q |
216 |
aaaacttatacagtactctgtctggtgacacctaatccagat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2950298 |
aaaacttatacagtactctgtctggtgacacctaatccagat |
2950257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University