View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21250_low_10 (Length: 257)

Name: NF21250_low_10
Description: NF21250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21250_low_10
NF21250_low_10
[»] chr5 (1 HSPs)
chr5 (16-257)||(2950257-2950498)


Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 257
Target Start/End: Complemental strand, 2950498 - 2950257
Alignment:
16 atacaaatacaatatctctgcatgatattactatgatagtggtgagatcaactttacaggctactagcattgaaggtattgaaagttcctaactcatata 115  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2950498 atacaaatacaatatctatgcatgatattactatgatagtggtgagatcaactttacaggctactagcattgaaggtattgaaagttcctaactcatata 2950399  T
116 atatctgtgtacagtatgtaaaggaattgcaaaaccacttgccagatatttgggatttgaccatatcattatgtacactttgtcctcttagagtctgtac 215  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2950398 atatctgtgtacagtatgtaaaggaattacaaaaccacttgccagatatttgggatttgaccatatcattatgtacactttgtcctcttagagtctgtac 2950299  T
216 aaaacttatacagtactctgtctggtgacacctaatccagat 257  Q
    ||||||||||||||||||||||||||||||||||||||||||    
2950298 aaaacttatacagtactctgtctggtgacacctaatccagat 2950257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University