View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21250_low_4 (Length: 295)
Name: NF21250_low_4
Description: NF21250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21250_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 90 - 178
Target Start/End: Complemental strand, 26039336 - 26039248
Alignment:
| Q |
90 |
gctaggatatctgtagaatggtatctattaatgtttatgaaaggggtcattgtctagtttagaaaaatagagatacatttagatttgta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26039336 |
gctaggatatctgtagaatggtatctattaatgtttacgaaatgggtcattgtctagtttagaaaaatagagatacatttagatttgta |
26039248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 122 - 202
Target Start/End: Complemental strand, 36161230 - 36161150
Alignment:
| Q |
122 |
gtttatgaaaggggtcattgtctagtttagaaaaatagagatacatttagatttgtacgagacaattggttaataaaaagg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161230 |
gtttatgaaaggggtcattgtctagtttagaaaaatagagatatatttagatttgtacgagacaattggttaataaaaagg |
36161150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 104 - 177
Target Start/End: Original strand, 38146743 - 38146817
Alignment:
| Q |
104 |
agaatggtatctattaatgt-ttatgaaaggggtcattgtctagtttagaaaaatagagatacatttagatttgt |
177 |
Q |
| |
|
|||||||||| ||| ||| | ||||| ||||||||||| ||||||||||||||||| |||||||| ||| ||||| |
|
|
| T |
38146743 |
agaatggtatttatgaatttgttatggaaggggtcattatctagtttagaaaaataaagatacatctaggtttgt |
38146817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 31 - 81
Target Start/End: Original strand, 38146511 - 38146561
Alignment:
| Q |
31 |
agggatcttgattggggaattaactccaagaacaatacaagttatatagaa |
81 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| | |||||| ||||||||| |
|
|
| T |
38146511 |
agggatcttgatttgggaattaactctaagaatagtacaagctatatagaa |
38146561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University