View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21250_low_6 (Length: 284)
Name: NF21250_low_6
Description: NF21250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21250_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 35200712 - 35200988
Alignment:
| Q |
1 |
tctcagcaaatgttactttctttgatgatacacccttccttcgcatcactaattatatcagggtctacaacagattttactctttttcaggcactaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200712 |
tctcagcaaatgttactttctttgatgatacacccttccttcgcatcactaattatatcagggtctacaacagattttactctttttcaggcactaccta |
35200811 |
T |
|
| Q |
101 |
ttcatatatatatttagcatatatttgtataatcacagtacctcacagttacgtagtgatctaaagttggccacttttgtattacttatgagtgtcaaca |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35200812 |
ttcatat--atatttagcatatatttgtataatcacagtacctcacagttacgtagtgatctaaagttggccgcttttgtattacttatgagtgtcaaca |
35200909 |
T |
|
| Q |
201 |
tatagaacctttaatccatgtcttatttataactttttgagttatcagcgcgtctcctgtccattatgcctttgcttct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
35200910 |
tatagaacctttaatccatgtcttatttataactttttgagttatcagcgcgtctcctgtccattatgcttttgtttct |
35200988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University