View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21251_high_4 (Length: 255)
Name: NF21251_high_4
Description: NF21251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21251_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 36095430 - 36095229
Alignment:
| Q |
16 |
atgaatatagagattttagggttaatagtgtttttggcatttggtaaaaataa-tgcttttggttcttgtaatatggggtgaaagtgtgaaactaggtaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095430 |
atgaatatagagattttagggttaatagtgtttttggcatttggtaaaaaaaaatgtttttggttcttgtaatatggggtgaaagtgtgaaactaggtaa |
36095331 |
T |
|
| Q |
115 |
atcttgttttatagattccacctctatcactttagatttttcaactttcagtcattcatggaatctggccatgcgaaatccttgatgtggtacactgtat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095330 |
atcttgttttatagattccacctctatcactttagatttttcaactttcagtcattcatggaatctggccatgcgaaatccttgatgtggtacactgtat |
36095231 |
T |
|
| Q |
215 |
ca |
216 |
Q |
| |
|
|| |
|
|
| T |
36095230 |
ca |
36095229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University