View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21251_low_8 (Length: 238)
Name: NF21251_low_8
Description: NF21251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21251_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 47 - 186
Target Start/End: Original strand, 36094924 - 36095063
Alignment:
| Q |
47 |
ccattattaaaaatatttgggttcatccccaacgtcggctaccgatggtcgtgacttgtgaaaccagttcaccacctgaccgccaccatttttctcctct |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
36094924 |
ccattattaaaaatatttgggttcatccccaacgtcggctaccgatggtcgtgacttgtgaaaccagttcaccacctgaccaccaccattcttctcctct |
36095023 |
T |
 |
| Q |
147 |
ctcagaatcatatctctttccatccaatggaatgtcactg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095024 |
ctcagaatcatatctctttccatccaatggaatgtcactg |
36095063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 36095102 - 36095153
Alignment:
| Q |
187 |
tccactgatgtcgtcttgtgagctcctctatcaaatctgttgttaaataatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095102 |
tccactgatgtcgtcttgtgagctcctctatcaaatctgttgttaaataatt |
36095153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University