View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21254_low_11 (Length: 244)
Name: NF21254_low_11
Description: NF21254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21254_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 62 - 227
Target Start/End: Complemental strand, 11659431 - 11659267
Alignment:
| Q |
62 |
accatgatatactgactgcgtgaatgtatgaatcacccaaactgacaattcaaattctaaaacacatcatatacagtacaaggcttagtggaaagagcct |
161 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11659431 |
accatgatatactgcctgcgtgaatgtatggataaccgaaactggcaattcaaattctaaaacacatcatatacagtacaaggcttagtggaaatagcct |
11659332 |
T |
|
| Q |
162 |
tgaacctgatgcatattctgtatgtgaatagctattgaacattgaagagaagtgataggtacatgt |
227 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11659331 |
t-aacctgatgcatattctatatgtgaatagctattgaacattgaagagtagtgataggtacatgt |
11659267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University