View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_high_30 (Length: 243)
Name: NF21255_high_30
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 10586973 - 10586769
Alignment:
| Q |
17 |
ttatactatgcaggctcttgcagctatgtctgatcagttatcatttagagccaagaggtactgcagttttgaaccatttctttattttcagaaatttatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586973 |
ttatactatgcaggctcttgcagctatgtctgatcagttatcatttagagccaagaggtactgcagttttgaaccatttctttattttcagaaatttatt |
10586874 |
T |
|
| Q |
117 |
tgaagatgcaaatttactttgattaatggctgtgcatgaannnnnnnnnctttagcctcttcacaccagtccttggaactttaaggaaaaatgaggaatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586873 |
tgaagatgcaaatttactttgattaatggctgtgcatgaatttttttttctttagcctcttcacaccagtccttggaactttaaggaaaaatgaggaatc |
10586774 |
T |
|
| Q |
217 |
aaccc |
221 |
Q |
| |
|
||||| |
|
|
| T |
10586773 |
aaccc |
10586769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University