View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_high_31 (Length: 243)
Name: NF21255_high_31
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 216
Target Start/End: Original strand, 31792099 - 31792300
Alignment:
| Q |
5 |
caatattattatagaaaaagaagatccttagatttataccttttgaacaatgaacatctggataaactattaaagcccaatatgcaaaatagttctataa |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||| || | |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31792099 |
caatattattatagaaaaagaagatccctagatttatatcttttgaacaatgaacgtcagtataaactattaaagcccaatatgcaaaacagttctataa |
31792198 |
T |
|
| Q |
105 |
ttgggcctcccaacaaagtctagatgtgcggttctcaaaatttaactaagtaaactacggatcccttactgttttatagaatatcgcactcctctcgatt |
204 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31792199 |
ttgggcctcccaacaaagtctagat-tgcggttctcaaaatttaactaagtaaactacggat---------ttttatagaatatcgcactcctctcgatt |
31792288 |
T |
|
| Q |
205 |
tgtcaatccaga |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31792289 |
tgtcaatccaga |
31792300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University