View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_high_40 (Length: 220)
Name: NF21255_high_40
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 204
Target Start/End: Original strand, 2782279 - 2782473
Alignment:
| Q |
10 |
tgagatgaagaagaaatgtgagttgtgcaaaagtccagcaaagttgttctgtgaatcagatcaggcaagcctttgttgggaatgtgatgctaaggttcac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782279 |
tgagatgaagaagaaatgtgagttgtgcaaaagtccagcaaagttgttctgtgaatcagatcaagcaagcctttgttgggaatgtgatgctaaggttcac |
2782378 |
T |
 |
| Q |
110 |
actgcaaacttcatagtcacaaagcatcacaggtttcttctctgccatatttgtcaatctttaacaccttggcatggcactggacccaagtttgt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782379 |
actgcaaacttcatagtcacaaagcatcacaggtttcttctctgccatatttgtcaatctttaacaccttggcatggcactggacccaagtttgt |
2782473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University