View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_high_41 (Length: 201)
Name: NF21255_high_41
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 186
Target Start/End: Complemental strand, 16459213 - 16459053
Alignment:
| Q |
26 |
aacataacactaaaatcccccctagtatcataatcagagcatttagagtaaagctcacattgttcacatagcataaggctcacttaatcgtattcgcata |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16459213 |
aacataacactaaaatcccccctagtatcataatcagagcatttagagtaaagctcacattgttcacatagcataaggctcacttaatcgtattcgcata |
16459114 |
T |
|
| Q |
126 |
acactttgacaattacacagttactatggtgcacatgtatgtacacttgacacttctattt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16459113 |
acactttgacaattacacagttactatgatgcacatgtatgtacacttgacacttctattt |
16459053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University