View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_low_31 (Length: 245)
Name: NF21255_low_31
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_low_31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 6 - 245
Target Start/End: Complemental strand, 46220147 - 46219914
Alignment:
| Q |
6 |
catagggacaactaacagaggtccaacctatgcacgcctggagtctggacggccaacaaggtcaaatacagagaattatatcactacatat-aaaaaact |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
46220147 |
catagggacaactaacagaggtccaacctatgcacgcctggagtctggacggccaacaaggtccaatacagagaat--tatcactacatataaaaaaact |
46220050 |
T |
|
| Q |
105 |
gcaagcaatattactcaactaccctcatagactcatacatacaattgagaattcaattgtgtattctttggccacattgacacctagttaaataaataaa |
204 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46220049 |
gcaagcaatatcactcaactaccctcatagact----catacaattgagaattcaattgtgtattc-ttggccacattgacacctagttaaataaataaa |
46219955 |
T |
|
| Q |
205 |
tacatgatgatgaaaccactcaattgggtttattgtcccca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46219954 |
tacatgatgatgaaaccactcaattgggtttattgtcccca |
46219914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University