View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_low_37 (Length: 239)
Name: NF21255_low_37
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 4583439 - 4583638
Alignment:
| Q |
1 |
gtttacttttttgtaagaataattactgacaaagatttgtttaattcaccgtataacttcatattaataaggttcaattttcttaagaatgagtgggtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4583439 |
gtttacttttttgtaagaataattactgacaaagatttgtttaattcaccgtataacttcatattaataaggttcaattttcttaagaatgagagggtaa |
4583538 |
T |
|
| Q |
101 |
acnnnnnnnnntatacattgatgatacttttaggttttagagagagcttttttgtagatttcacaacatatataaattgaaataaatttcccaacaaaaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4583539 |
acaaaaaaaaatatacattgatgatacttttaggttttagagagagcttttttgtagatttcacaac----ataaattgaaataaatttcccaacaaaaa |
4583634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 89
Target Start/End: Complemental strand, 38299011 - 38298929
Alignment:
| Q |
7 |
ttttttgtaagaataattactgacaaagatttgtttaattcaccgtataacttcatattaataaggttcaattttcttaagaa |
89 |
Q |
| |
|
|||||||||| | |||||| |||||||| ||| ||||||| | ||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
38299011 |
ttttttgtaaaattaattattgacaaagctttatttaatttatggtataacttcatatttataaagttcatttttcttaagaa |
38298929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 169
Target Start/End: Complemental strand, 38298891 - 38298849
Alignment:
| Q |
127 |
cttttaggttttagagagagcttttttgtagatttcacaacat |
169 |
Q |
| |
|
|||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
38298891 |
cttttaggttttagagagagtttctttttagatttcacaacat |
38298849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University