View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21255_low_38 (Length: 238)
Name: NF21255_low_38
Description: NF21255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21255_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 44805492 - 44805295
Alignment:
| Q |
21 |
tgtatctaaaccatggaatatcaaaattgcttatttataatcaataacaaacaggccctaaaattgatgatctctaattgattgacgaacatttaaaaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805492 |
tgtatctaaaccatggaatatcaaaattgcttatttataatcaataacaaacaggccctaaaattgatgatctctaattgattgacgaacatttaaaaga |
44805393 |
T |
 |
| Q |
121 |
atcctatcgaaatccaacaacctgtttcaactgcagcatcaggttgtggagcaagtacagaattttcatcagcagatcctaagcaaagaccgtgcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44805392 |
atcctatcgaaatccaacaacctgtttcaactgcagcatcaggttgtggagcaagtacagaattttcatcagcagatcctaagcaaagcccgtgcaag |
44805295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University