View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_12 (Length: 364)
Name: NF21256_high_12
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 287
Target Start/End: Original strand, 2778011 - 2778288
Alignment:
| Q |
14 |
cagtcgggacaggcgcaatcaagatgcggtcaacatctcagaaccgtgattttattttttcagatcattggtcatttgggg----gtttgtattcgctaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2778011 |
cagtcgggacaggcgcaatcaagatgcggtcaacatctcagaaccgtgattttattttttcagatcattggtcatttgggggtttgtttgtattcgctaa |
2778110 |
T |
|
| Q |
110 |
aaattgttttatttgttcaagtaatatggcgaaacactagtgaggagaggaccctcnnnnnnnngtcaacattggtccattgagtcttcctcttccctta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778111 |
aaattgttttatttgttcaagtaatatggcgaaacactagtgaggagaggaccctcttttttttgtcaacattggtccattgagtcttcctcttccctta |
2778210 |
T |
|
| Q |
210 |
taatatgttgatgattgttttacatatgccccctgcattcccataaaatccccttaaaatatcacttaagataataag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778211 |
taatatgttgatgattgttttacatatgccccctgcattcccataaaatccccttaaaatatcacttaagataataag |
2778288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University