View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_15 (Length: 322)
Name: NF21256_high_15
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 309
Target Start/End: Complemental strand, 45934307 - 45934022
Alignment:
| Q |
18 |
aatgcatcaaaatacccaaattctacactatcaccaacaatgtacaactctatgaacatgtccgaccagatcaagaacagcgaagatcctgnnnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45934307 |
aatgcatcaaaatacccaaattcgacactatcaccaacaatgtacaactctatgaacatgtccgaccagatcaagaacaacgaagatcctgacaacaaca |
45934208 |
T |
 |
| Q |
118 |
nnnnnnnnnntcacatccatttcgattccccaaccctcgaagatgcttccggcgaaggtgaaggtcaaatcaatgatgtttcactcgaaaatgtttatgt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934207 |
acaa------tcacatccatttcgattcaccaaccctcgaagatgcttccggcgaaggtgaaggtcaaatcaatgatgtttcactcgaaaatgtttatgt |
45934114 |
T |
 |
| Q |
218 |
gtccggcgatggaaaccaccctgatatgtctgttcaacaattcgacgattctagccagctcacactttcgtttcgtggccaagtttatgtct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934113 |
gtccggcgatggaaaccaccctgatatgtctgttcaacaattcgacgattctagccagctcacactttcgtttcgtggccaagtttatgtct |
45934022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University