View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_18 (Length: 289)
Name: NF21256_high_18
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 50128637 - 50128455
Alignment:
| Q |
1 |
tactattaagaaattgacgtgattataggcactgacgtcctgtgcaacattataaaatgtaattttactctttttatattaaaaactccactagcannnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50128637 |
tactattaagaaattgacgtgattataggcactgacgtaccgtgcaacattataaaatgtaattttactctttttatattaaaaactccactagcatttt |
50128538 |
T |
 |
| Q |
101 |
nnngcttcagcagtcacccacccccaaaccccaacatcatcgcatcaacacaacaatggccacaaattttgcttcaaggtcga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50128537 |
tttgcttcagcagtcacccacccccaaaccccaacatcatcgcatcaacacaacaatggccacaaattttgcttcaaggtcga |
50128455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 27231439 - 27231489
Alignment:
| Q |
126 |
aaaccccaacatcatcgcatcaacacaacaatggccacaaattttgcttcaag |
178 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27231439 |
aaacccaaacatcatc--atcaacataacaatggccacaaattttgcttcaag |
27231489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University