View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_19 (Length: 289)
Name: NF21256_high_19
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 34273665 - 34273928
Alignment:
| Q |
1 |
tgaacacataaaaacattaacaggttgctacaattgtataccagtagttatagtatcccatctgctgggatatggtgggaccattgagacaatagtccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273665 |
tgaacacataaaaacattaacaggttgctacaattgtgtacca------atagtatcccatctgctgggatatggtgggaccattgagacaatagtccaa |
34273758 |
T |
 |
| Q |
101 |
ttaaaatggaaaatggacctatcaggtttctctttgcactcttcaatccaaaagtatgttatattattaacacctaaattcattttgatgaaacctaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273759 |
ttaaaatggaaaatggacctatcaggtttctctttgcactcttcaatccaaaagtatgttatattattaacacctaaattcattttgatgaaacctaact |
34273858 |
T |
 |
| Q |
201 |
tcttaatttttggacaattgcacctaacttcttaagtagcctgatttctcgagttattacactgacatgc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273859 |
tcttaatttttggacaattgcacctaacttcttaagtagcctgatttctcgagttattacactgacatgc |
34273928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University