View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_25 (Length: 240)
Name: NF21256_high_25
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 47285692 - 47285895
Alignment:
| Q |
19 |
cacctagttgctagacttgccaaggtttcaatatcattcagtggagaacacatgtcatttccctctcatagaagagcagtccaaattgtggaagacaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285692 |
cacctagttgctagacttgccaaggtttcaatatcattcagtggagaacacatgtcatttccctctcatagaagagcagtccaaattgtggaagacaatt |
47285791 |
T |
|
| Q |
119 |
gcaaaagctaggaaccgaataaggacatgctcatggctagaaaccacagaagggccaagcataagagaatcagttttcagaaccggtgaaagtgttttag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
47285792 |
gcaaaagctaggaaccgaataaggacatgctcatggctagaaaccaaagaagggccaagcataagagaataagttttcagaaccggggaaagtgttttag |
47285891 |
T |
|
| Q |
219 |
aatg |
222 |
Q |
| |
|
|||| |
|
|
| T |
47285892 |
aatg |
47285895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 158
Target Start/End: Original strand, 47279965 - 47280067
Alignment:
| Q |
60 |
tggagaacacatgtcatttccctctca----tagaagagcagtccaaattgtggaagacaattgcaaaagctaggaaccgaataaggacatgctcatggc |
155 |
Q |
| |
|
||||||| |||| | |||||||||||| |||||||||| || || |||||||||| || ||||||| || ||||| ||| ||||||||||||| || |
|
|
| T |
47279965 |
tggagaaaacatttaatttccctctcaaacctagaagagcaatctaatttgtggaagaaaaatgcaaaatcttagaacctaatgaggacatgctcatagc |
47280064 |
T |
|
| Q |
156 |
tag |
158 |
Q |
| |
|
||| |
|
|
| T |
47280065 |
tag |
47280067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University