View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_high_29 (Length: 206)
Name: NF21256_high_29
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_high_29 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 33633464 - 33633666
Alignment:
| Q |
1 |
catctgccctaaatcccatcatagaattctcaaagctactattccgtttgggttaatctaagcatgtagtttccaatcatctcattgcggattacattaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33633464 |
catctgccctaaatcccgtcatagaacactcaaagttactattccatttgggttaatctaagcatgttgtttccaatcatctcattgcggattacattaa |
33633563 |
T |
|
| Q |
101 |
aaatattcctttggcatgatgataaatcaagtagtggctcagtctaatcatttcttcnnnnnnnctataacggaagtaaattttcattcaacgataaacg |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33633564 |
aaatattcctttggc---atgataaatcaagtagtggttcagtctaatcatttcttctttttttctataacggaaataaattttcattcaacgataaacg |
33633660 |
T |
|
| Q |
201 |
gaagat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33633661 |
gaagat |
33633666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University