View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_low_14 (Length: 361)
Name: NF21256_low_14
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 9285882 - 9286243
Alignment:
| Q |
1 |
gcaccaaattccatacttaccgaccattgtagagcaatgnnnnnnntgcaatgtctttgatcgacattggcgctggttgcaacatctaatgagaaaggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9285882 |
gcaccaaattccatacttaccgaccattgtagagcaatgaaaaaaatgcaatgtctttgatcgccatcggcgctggttgcaacatctaatgagaaaggtt |
9285981 |
T |
|
| Q |
101 |
tcagaaaagttggatag---------ttatgagtctatcaaaacacttttgcatggtgctagctatttatgatgcaccaaacttacctacatacttcaaa |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9285982 |
tcagaaaagttggataggcactgtgattatgagtctatcaaaacacttttgcatggtgctagctctttatgatgcatcaaacttacctacatacttcaaa |
9286081 |
T |
|
| Q |
192 |
gttcaaaccctatcagccatcttcatttcaaaagaataaaattaaaagaataagacaaatagagaaggaagaagaatacctcatggaaccatcatcgtat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9286082 |
gttcaaaccctatcagccatcttcatttcaaaagaataaaattaaaagaataagacaaatagagaaggaagaagaatacctcatggaaccatcatcgtat |
9286181 |
T |
|
| Q |
292 |
gcagccatcaaattaaaccctatcctaccggttgaggttccttctgtttttccatattcttc |
353 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9286182 |
gcagccatcaaattaaaccctatcctgccggttgaggttccttctgtttttccatattcttc |
9286243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University