View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_low_17 (Length: 319)
Name: NF21256_low_17
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 313
Target Start/End: Complemental strand, 34876817 - 34876520
Alignment:
| Q |
19 |
actttctaaaccaaaagatcaaatattagattgagctgcactttcttcaggattaagtctttgcaagctcgtaaaccacatcattgccataatttgct-- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34876817 |
actttctaaaccaaaagatcaaatattagattgagctgcactttcttcaggattaactctttgcaagctcgtaaaccacatcattgccataatttgctgc |
34876718 |
T |
 |
| Q |
117 |
-acggtgaattgtctgccataatgttaatgtggtttccgctggtgaatcaatttggtttacggttttttatttaatatggttttcatatcggataaattt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
34876717 |
tacggtgaattgtcttccataatgttaatgtggtttccgctgatgaatcaatttggtttgcggttttttatttaatgtgattttcatatcaaataaattc |
34876618 |
T |
 |
| Q |
216 |
tcaatgcttcatgttaatgtattgtgagtttaagcggagatgttagataacatgtaaagagaattatgttataattggactaaagatagtataatcta |
313 |
Q |
| |
|
|||||| || ||||||||||||||||||||| | |||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
34876617 |
tcaatgttttatgttaatgtattgtgagtttgaacggagatgttagataacatgaaaagagaattttgttataattggactaaagatagtttaatcta |
34876520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University