View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_low_24 (Length: 253)
Name: NF21256_low_24
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 10051111 - 10050883
Alignment:
| Q |
17 |
cacccttctcaatgtccaaggcatatactataacattgcccatctcatattgcatctatgattcagtaatatgataccatgaatataaatgctcttacgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10051111 |
cacccttctcaatgtccaaggcatatactataacattgcccatctcatattgcatctatgattcagtgatatgataccatgaatataaatgctcttacgt |
10051012 |
T |
 |
| Q |
117 |
tggtgatcatgtatatagctagtcgcagataataataccacataaatttcaaaaatcttttttgttttgtttgagagtaagtagtgatgtgatggggttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
10051011 |
tggtgatcatgtatatagctagtcgcagataataataccacataaatttcaaaaatct-ttttgttttgtttgagagtaagttgtgatgtgatgaggttg |
10050913 |
T |
 |
| Q |
217 |
actgacttgaactagaactccttcatctca |
246 |
Q |
| |
|
|| ||||| ||||||||||||||||||||| |
|
|
| T |
10050912 |
acggacttcaactagaactccttcatctca |
10050883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University