View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21256_low_28 (Length: 239)

Name: NF21256_low_28
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21256_low_28
NF21256_low_28
[»] chr4 (1 HSPs)
chr4 (1-223)||(13954227-13954449)
[»] chr3 (1 HSPs)
chr3 (1-50)||(9865216-9865265)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 13954227 - 13954449
Alignment:
1 gttgattttgctaataacccattttgaaactcttccttccctaggaaaacatattccagttataaatgcacttagaattggattatagttatatactatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13954227 gttgattttgctaataacccattttgaaactcttccttccctaggaaaacatattccagttataaatgcacttagaattggattatagttatatactatt 13954326  T
101 gatgaagcacaaatcataaccatgaatgcaagtgatagtaccaaatgtgatcctttcataggtttcccttcagggttttcattgtcaacccatttcatga 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13954327 gatgaagcacaaatcataaccatgaatgcaagtgataataccaaatgtgatcctttcataggtttcccttcagggttttcattgtcaacccatttcatga 13954426  T
201 aaaccggtgcaaacattgctgtg 223  Q
    |||||||||||||| ||||||||    
13954427 aaaccggtgcaaacgttgctgtg 13954449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 9865265 - 9865216
Alignment:
1 gttgattttgctaataacccattttgaaactcttccttccctaggaaaac 50  Q
    |||||||||| | ||||||||||||||||| || ||||||||||||||||    
9865265 gttgattttggtgataacccattttgaaaccctaccttccctaggaaaac 9865216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University