View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21256_low_28 (Length: 239)
Name: NF21256_low_28
Description: NF21256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21256_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 13954227 - 13954449
Alignment:
| Q |
1 |
gttgattttgctaataacccattttgaaactcttccttccctaggaaaacatattccagttataaatgcacttagaattggattatagttatatactatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13954227 |
gttgattttgctaataacccattttgaaactcttccttccctaggaaaacatattccagttataaatgcacttagaattggattatagttatatactatt |
13954326 |
T |
|
| Q |
101 |
gatgaagcacaaatcataaccatgaatgcaagtgatagtaccaaatgtgatcctttcataggtttcccttcagggttttcattgtcaacccatttcatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13954327 |
gatgaagcacaaatcataaccatgaatgcaagtgataataccaaatgtgatcctttcataggtttcccttcagggttttcattgtcaacccatttcatga |
13954426 |
T |
|
| Q |
201 |
aaaccggtgcaaacattgctgtg |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
13954427 |
aaaccggtgcaaacgttgctgtg |
13954449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 9865265 - 9865216
Alignment:
| Q |
1 |
gttgattttgctaataacccattttgaaactcttccttccctaggaaaac |
50 |
Q |
| |
|
|||||||||| | ||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9865265 |
gttgattttggtgataacccattttgaaaccctaccttccctaggaaaac |
9865216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University