View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21257_high_20 (Length: 252)
Name: NF21257_high_20
Description: NF21257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21257_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 40825892 - 40826136
Alignment:
| Q |
1 |
ttataattttattctattttgaataaaaatgaaaaa-ggacggtgggatgtgtatnnnnnnntatagctatgtctatgagttttagctgggctatgattg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40825892 |
ttataattttattctattttgaataaaaatgaaaaaaggacggtgggatgtgtataaaaaaatatagctatgtctatgagttt-agctgggctatgattg |
40825990 |
T |
 |
| Q |
100 |
aattgagtaaatctcttgcttgtgatgtaaccaaaatattttgagttgtccttgatataatgtgatgctgtataaagttgtggcaagcagttcaaaagca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825991 |
aattgagtaaatctcttgcttgtgatgtaaccaaaatattttgagttgtccttggtataatgtgatgctgtataaagttgtggcaagcagttcaaaagca |
40826090 |
T |
 |
| Q |
200 |
gcagcatgtcaatctggttgcagtacatgggacatgatagaataat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40826091 |
gcagcatgtcaatctggttgcagtacatgggacatgatagaataat |
40826136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University