View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21257_high_28 (Length: 227)
Name: NF21257_high_28
Description: NF21257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21257_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 43 - 201
Target Start/End: Complemental strand, 2265076 - 2264918
Alignment:
| Q |
43 |
ctaacataactgtctcctgacccagaaatgagattggtattcattgaaatgaacatatatacttaattacacaatcaccttccacaactgtctgatgtag |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265076 |
ctaacataactgtctcctgacccagaaatgagattggtattcattgaaatgaacatatatacttaattacacaatcaccttccacaactgtctgatgtag |
2264977 |
T |
 |
| Q |
143 |
acttaggacctcatattagctttgcaaagtatatgaaatcaaaacatgagctgtccaga |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264976 |
acttaggacctcatattaactttgcaaagtatatgaaatcaaaacatgagctgtccaga |
2264918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University