View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21257_low_26 (Length: 238)
Name: NF21257_low_26
Description: NF21257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21257_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 40825608 - 40825833
Alignment:
| Q |
17 |
agatatgctgggtggctta----agtttagagtccacccttctttgtaattagtgatatatataatacctgcatctttgttctcacaactttctggcact |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40825608 |
agatatgctgggtggcttacttaagtttagagtccacccttttttgtaattagtgatatatataatacctgcatctttgttctcacaactttttggcact |
40825707 |
T |
 |
| Q |
113 |
gtatatagtgcttaatacagtaatactataacatttgaccactgtatctgacaattataaggccgtcattatctctttatgaaagaaacgtttcaccctc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825708 |
gtatatagtgcttaatacagtaatactataacatttgaccactgtatctgacaattataaggccgtcattatctctttatgaaagaaacgtttcaccctc |
40825807 |
T |
 |
| Q |
213 |
caaatttaatcttgccacatcatcaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40825808 |
caaatttaatcttgccacatcatcaa |
40825833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University