View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21257_low_27 (Length: 238)
Name: NF21257_low_27
Description: NF21257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21257_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 30761502 - 30761283
Alignment:
| Q |
1 |
tccgggatttcgcacccaagtttagcacataatatataaatatcttgtcaattttagctccgaatattctgagagtgagatttctcaggggtctcctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
30761502 |
tccgggatttcgcacccaagtttagcacataatatataaatatcttgtcaattttagctccgaatattctgagagtgagagttctcaggggtctccggct |
30761403 |
T |
|
| Q |
101 |
ccgcccatcgggtggaatcagaccctttccggtgtatttcccatcgggaggaatcaaaccctttccgatgtattaccctcacaatttattatcaaccaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30761402 |
ccgcccatcgggtggaatcagaccctttccggtatattttccatcgggaggaatcaaaccctttccgatg--ttaccctcacaatttattatcaaccaat |
30761305 |
T |
|
| Q |
201 |
tatatatgtaatatatattcat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30761304 |
tatatatgtaatatatattcat |
30761283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University