View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21258_low_15 (Length: 218)
Name: NF21258_low_15
Description: NF21258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21258_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 7881156 - 7880973
Alignment:
| Q |
19 |
tgtctaaagaattttgtcattagttttgtatacgtcgaattttaacggtagaaaataaatggctcattttgtgttttcttcttttgcttatttaatatat |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
7881156 |
tgtctaaagaattttgttattagttttgtatacgtcgaattttaacggtagaaaataaatggctcaatttgtgttttcttcttttgcttttttaatatat |
7881057 |
T |
|
| Q |
119 |
cttggaccccacaaaaattgtctcttcctgcatgattggaatacgtacaccaataattctgcacaacatgcagctaccgttcat |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7881056 |
cttggaccccacaaaaaatgtctcttcctgcatgattggaatacgtacaccaataattctgcacaacatgcagctaccgttcat |
7880973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University