View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_40 (Length: 322)
Name: NF2125_high_40
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_40 |
 | |
|
| [»] scaffold0512 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 45172579 - 45172883
Alignment:
| Q |
1 |
tagagaaaccggcagtactaatcatacttatatttacaatcacccttcaatgatgatgagagagttggtactttcaatggcaatggattggcgtggatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45172579 |
tagagaaaccggcagtactaatcatacttatattgacaatcacccttcaatgatgatgagagagttggtactttcaatggcaatggattggcgtggatgt |
45172678 |
T |
|
| Q |
101 |
caatatctgcaggcgaagatcgagaagggcaacccggcagatgttgagtttatcctctcaatcgtgaaggatcatgtacaccagctaatgacacacaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45172679 |
caatatctgcaggcgaagatcgagaagggcaacccggcagatgttgagtttatcctctcaatcgtgaaggatcatgtacaccagctaatgacacacaaca |
45172778 |
T |
|
| Q |
201 |
acaactacttgattaaaaagatttttcaagcaaggagtggtgtcaccccggagcagatggaatctattgttttatcgattatctcggatgatcaaaagct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45172779 |
acaactacttgattaaaaagatttttcaagcaaggagtggtgtcaccccggagcagatggaatctattgttttatcgattatctcggatgatcaaaagct |
45172878 |
T |
|
| Q |
301 |
gaaac |
305 |
Q |
| |
|
||||| |
|
|
| T |
45172879 |
gaaac |
45172883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0512 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0512
Description:
Target: scaffold0512; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 302
Target Start/End: Original strand, 2382 - 2478
Alignment:
| Q |
202 |
caactacttgattaaaaagatttttcaagcaaggagtggtgtcaccccggagcagatggaatctattgttttatcgattatctcggatgatcaaaagctg |
301 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| || |||||||| |||| |||| || ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2382 |
caactacttgattcaaaagatttttcaaccaagaagcggtgtcacgtgggagtagattgactctattgtttt----attatctaggatgatcaaaagctg |
2477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University