View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_42 (Length: 319)
Name: NF2125_high_42
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 18501728 - 18501422
Alignment:
| Q |
1 |
cttttaagttcttaacttattacatcaagtgttaatatgctagcacatatttttctccttgtgaatacttgaacctgaagttttaacttcttaacttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18501728 |
cttttaagttcttaacttattacaacaattgttaatatgctggcacatatttttctccttgtcaatacttgaacctgaatttttaacttcttaacttatt |
18501629 |
T |
 |
| Q |
101 |
taatcccttgtctaaaatcaattgagttactttttacaaaatttacactttattttgccaaacttattgatgatccaaacgaagcacacaattgtcatat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18501628 |
taatcctttgtctaaaatcaattgagttactttttacaaaatttacactttattttgccaaacacattgatgatccaaacgaagaacacaattgtcatat |
18501529 |
T |
 |
| Q |
201 |
ttccatttcctcatcatcttgggtatcttttcactctcnnnnnnnnctgttgtaagcagactatccaagtttgttcattcaaacccatcccattgttgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18501528 |
ttccatttcctcatcatcttgggtatcttttcactctc-tttttttctgttgtaagcagactatccaaatttgttcattcaaacccatcccattgttgtc |
18501430 |
T |
 |
| Q |
301 |
ttgtctct |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
18501429 |
ttgtctct |
18501422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University