View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_48 (Length: 293)
Name: NF2125_high_48
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_48 |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 30805184 - 30805050
Alignment:
| Q |
10 |
ataattcttagtactttgtgtgaaatggtaaactgattcggttaaattgggatggatggagtattaaataacattgctctttagaaaaacgtccttagcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805184 |
ataattcttagtactttgtgtgaaatggtaaactgactcagttaaattgggacggatgaagtattaaataacattgctctttagaaaaacgtccttagct |
30805085 |
T |
 |
| Q |
110 |
tatgccttgctcttcatatgtcctactttttgtag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805084 |
tatgccttgctcttcatatgtcctactttttgtag |
30805050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 30804963 - 30804925
Alignment:
| Q |
234 |
atggaatccttttcttatttaaaatatccttaaataata |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30804963 |
atggaatccttttcttatttaaaatatcctaaaataata |
30804925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 101 - 134
Target Start/End: Complemental strand, 46672438 - 46672405
Alignment:
| Q |
101 |
tccttagcctatgccttgctcttcatatgtccta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46672438 |
tccttagcctatgccttgctcttcatatgtccta |
46672405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 8974999 - 8974954
Alignment:
| Q |
89 |
tttagaaaaacgtccttagcctatgccttgctcttcatatgtccta |
134 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8974999 |
tttagaaaaacatccttagcctatgccttgctcttcatatgtccta |
8974954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 20599 - 20652
Alignment:
| Q |
26 |
tgtgtgaaatggtaaactgattcggttaaattgggatggatggagtattaaata |
79 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||| ||||||| ||||| |
|
|
| T |
20599 |
tgtgtgaaatggtaaactgactcaattaaattgggacggagggagtataaaata |
20652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 144
Target Start/End: Complemental strand, 47631930 - 47631902
Alignment:
| Q |
116 |
ttgctcttcatatgtcctactttttgtag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47631930 |
ttgctcttcatatgtcctactttttgtag |
47631902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University