View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2125_high_48 (Length: 293)

Name: NF2125_high_48
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2125_high_48
NF2125_high_48
[»] chr4 (3 HSPs)
chr4 (10-144)||(30805050-30805184)
chr4 (234-272)||(30804925-30804963)
chr4 (101-134)||(46672405-46672438)
[»] chr2 (1 HSPs)
chr2 (89-134)||(8974954-8974999)
[»] scaffold0250 (1 HSPs)
scaffold0250 (26-79)||(20599-20652)
[»] chr1 (1 HSPs)
chr1 (116-144)||(47631902-47631930)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 30805184 - 30805050
Alignment:
10 ataattcttagtactttgtgtgaaatggtaaactgattcggttaaattgggatggatggagtattaaataacattgctctttagaaaaacgtccttagcc 109  Q
    |||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||     
30805184 ataattcttagtactttgtgtgaaatggtaaactgactcagttaaattgggacggatgaagtattaaataacattgctctttagaaaaacgtccttagct 30805085  T
110 tatgccttgctcttcatatgtcctactttttgtag 144  Q
    |||||||||||||||||||||||||||||||||||    
30805084 tatgccttgctcttcatatgtcctactttttgtag 30805050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 30804963 - 30804925
Alignment:
234 atggaatccttttcttatttaaaatatccttaaataata 272  Q
    |||||||||||||||||||||||||||||| ||||||||    
30804963 atggaatccttttcttatttaaaatatcctaaaataata 30804925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 101 - 134
Target Start/End: Complemental strand, 46672438 - 46672405
Alignment:
101 tccttagcctatgccttgctcttcatatgtccta 134  Q
    ||||||||||||||||||||||||||||||||||    
46672438 tccttagcctatgccttgctcttcatatgtccta 46672405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 8974999 - 8974954
Alignment:
89 tttagaaaaacgtccttagcctatgccttgctcttcatatgtccta 134  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||    
8974999 tttagaaaaacatccttagcctatgccttgctcttcatatgtccta 8974954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0250 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0250
Description:

Target: scaffold0250; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 20599 - 20652
Alignment:
26 tgtgtgaaatggtaaactgattcggttaaattgggatggatggagtattaaata 79  Q
    |||||||||||||||||||| ||  ||||||||||| ||| ||||||| |||||    
20599 tgtgtgaaatggtaaactgactcaattaaattgggacggagggagtataaaata 20652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 144
Target Start/End: Complemental strand, 47631930 - 47631902
Alignment:
116 ttgctcttcatatgtcctactttttgtag 144  Q
    |||||||||||||||||||||||||||||    
47631930 ttgctcttcatatgtcctactttttgtag 47631902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University