View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_6 (Length: 535)
Name: NF2125_high_6
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 35786639 - 35786868
Alignment:
| Q |
11 |
atcatcacttgcatgttcaaaatcttgatttagttgttgatgatgatattgttgatggtgttgcacttgcacttgcaccatttcttgatgagggttatga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786639 |
atcaccacttgcatgttcaaaatcttgatttagttgttgatgatgatattgttgatgctgttgcacttgcacttgcaccatttcttgatgagggttatga |
35786738 |
T |
|
| Q |
111 |
tgaaaatgaactaaaccattattgttattatagaaaactggttggtgatgatgatgaaaattattgtaaacaccaaatgggacaaaattattgtaaactg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786739 |
tgaaaatgaactaaaccattattgttattatagaaaactggttggtgatgatgatgaaaattattgtaaacaccaaatgggacaaaattattgtaaactg |
35786838 |
T |
|
| Q |
211 |
agaaaccagaaggacgaggaagtaaaggac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35786839 |
agaaaccagaaggacgaggaagtaaaggac |
35786868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 330 - 531
Target Start/End: Original strand, 35786958 - 35787159
Alignment:
| Q |
330 |
ttaagctgagccctagaaccatagagaataatagcagcacgatcataagctttagcagcatcttcagcagttgaaaaagtaccaagccatttacgagtac |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786958 |
ttaagctgagccctagaaccatagagaataatagcagcacgatcataagctttagcagcatcttcagcagttgaaaaagtaccaagccatttacgagtac |
35787057 |
T |
|
| Q |
430 |
gtttacgtggttcacgaatttcagcaacccatttaccccaactacgttgtcttacaccacggtatctgaatttgttgttatcaggtccacctttaccttt |
529 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787058 |
gtttacgtggttcacgaatttcagcaacccatttaccccaactacgttgtcttacaccacggtatctgaatttgttgttatcaggtccacctttaccttt |
35787157 |
T |
|
| Q |
530 |
gc |
531 |
Q |
| |
|
|| |
|
|
| T |
35787158 |
gc |
35787159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 437 - 470
Target Start/End: Original strand, 25896641 - 25896674
Alignment:
| Q |
437 |
tggttcacgaatttcagcaacccatttaccccaa |
470 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
25896641 |
tggttcacgaatctcagcaacccatttaccccaa |
25896674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 470
Target Start/End: Complemental strand, 52690586 - 52690554
Alignment:
| Q |
438 |
ggttcacgaatttcagcaacccatttaccccaa |
470 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
52690586 |
ggttcacggatttcagcaacccatttaccccaa |
52690554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University