View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2125_high_69 (Length: 251)

Name: NF2125_high_69
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2125_high_69
NF2125_high_69
[»] chr4 (1 HSPs)
chr4 (19-219)||(46823911-46824107)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 46824107 - 46823911
Alignment:
19 cacagaatataagtagaattgaattatgaatttgaacctaaaaacaatatagctagtgaacagaatattgggaagcattaatttcagtgaaaagtgaacg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||    
46824107 cacagaatataagtagaattgaattatgaatttgaacctaaaaacaat----ttagtgaacagaatattgggaagcattaatttcagtgaaaagtgaacg 46824012  T
119 aaatgtagaaggacacgtacggatgcatataccgggaaaccagcagtggcactcttatgcgatctagatatgttgttgcctgggacataacatcatgggc 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
46824011 aaatgtagaaggacacgtacggatgcatataccgggaaaccagcagtggcactcttatgcgatctagatatgttgttgcctgggacataaaatcatgggc 46823912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University