View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_82 (Length: 245)
Name: NF2125_high_82
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 50243506 - 50243727
Alignment:
| Q |
1 |
atagggattgcacgattatcagttttagttggtggagcttttgaggagcttcttattgtcatagctattttcgttgcaggttggattttatttttctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243506 |
atagggattgcacgattatcagttttagttggtggagcttttgaggagcttcttattgtcatagctattttcgttgcaggttggattttatttttctttc |
50243605 |
T |
|
| Q |
101 |
ttaagctgaatggaaaattgaggattgatgcgtgtgtgtgtgttgtcnnnnnnnnnnnnnnnntgtatgaaataccgacacatacaagacactgacacgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50243606 |
ttaagctgaatggaaaattgaggattgatgcgtgtgtgtgtgttgtc------atatatatgttgtatgaaatactgacacatacaagacactgacacgt |
50243699 |
T |
|
| Q |
201 |
tgacaccagtaataaatggagagcatgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50243700 |
tgacaccagtaataaatggagagcatgt |
50243727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University