View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2125_high_85 (Length: 241)
Name: NF2125_high_85
Description: NF2125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2125_high_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41883815 - 41884035
Alignment:
| Q |
1 |
ttattagtaattgcaggtgagttattgtgataagttaatagtaaaatacaataagttaggggggttggtatacatccatctttagaatgaagttagtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883815 |
ttattagtaattgcaggtgagttattgtgataagttaatagtaaaatacaataagttaggggggttggtatacatccatctttagaatgaagttagtgaa |
41883914 |
T |
 |
| Q |
101 |
tagtgagtgcttacgggtaaaagattttttatcttcttcatatgtgattgaaatttttagattttacgtcacaggttacctttagacatttgtcattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883915 |
tagtgagtgcttacgggtaaaagattttttatcttcttcatatgtgattgaaatttttagattttacgtcacaggttacctttagacatttgtcattgct |
41884014 |
T |
 |
| Q |
201 |
agttcctactccttcatttga |
221 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
41884015 |
atttcctactccttcatttga |
41884035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University